|
Mouse Strain information
|
||||||||||||||||
| APB ID | 9173 | |||||||||||||||
| Added | 08/04/2021 | |||||||||||||||
| Last Edited | 12/02/2025 | |||||||||||||||
| Strain nomenclature: | C57Bl/6NCrlAnu-Kif13aem1Anu/Apb | |||||||||||||||
| Nickname: | ASD1118:Kif13a G318R:F0 | |||||||||||||||
|
Genetics
|
||||||||||||||||
| Strain Types |
Inbred
|
|||||||||||||||
| Genetic Details |
CRISPR targeted
|
|||||||||||||||
| Mode of Inheritance | Semi-dominant | |||||||||||||||
|
||||||||||||||||
| CRISPR types |
Insertion/Tagging
|
|||||||||||||||
| Point mutation sequence: | ||||||||||||||||
| Insertion/Tagging details: | Using specific crRNA for Kif13a exon 11 together with ssODN as a donor an amino acid at the position 318 was changed from Glycine to Arginine. The nucleotide substitution of G>C and A>T was changed at positions Chr13: 46,968,907 and 46,968,909 respectively, using GRCm39 genome assembly. | |||||||||||||||
| Guide(s) RNA sequence: | Donor ssODN: ggtgttcaacaaggtgctgctatttgccattctttataggacaatttacgtgggaacagccagacctctatgatagcgaccatcagcccagcagcag Guide sequence: TCTTTATAGGACAATTTAGG AGG | |||||||||||||||
| Mutant Construction Technique | None | |||||||||||||||
|
Phenotype
|
||||||||||||||||
| Phenotype Homozygous State | Mouse #14 | |||||||||||||||
| Phenotype Heterozygous State | unknown | |||||||||||||||
| Genetic Background Currently Maintained | C57Bl/6NCrl | |||||||||||||||
|
Strain identification
|
||||||||||||||||
|
Fertility and Strain maintenance
|
||||||||||||||||
|
||||||||||||||||
|
Relevant bibliographic / database references
|
||||||||||||||||
|
General information
|
||||||||||||||||
| Associated IP rights? | Unknown | |||||||||||||||
| Does it Model a Human Condition? | Unknown | |||||||||||||||
| Is the strain available in any form to other researchers | Possibly | |||||||||||||||
| APB stock stored as: |
Cryopreserved sperm (from 1 mice)
|
|||||||||||||||
| Are live mice available? | Unknown | |||||||||||||||
| MTA needs to be signed? | Yes | |||||||||||||||
