|
Mouse Strain information
|
||||||||||||||||||||||
| APB ID | 9297 | |||||||||||||||||||||
| Added | 08/11/2021 | |||||||||||||||||||||
| Last Edited | 24/03/2022 | |||||||||||||||||||||
| Strain nomenclature: | C57Bl/6J-Robo2em1Mon/AnuApb | |||||||||||||||||||||
| Nickname: | Robo2 KO | |||||||||||||||||||||
|
Genetics
|
||||||||||||||||||||||
| Genetic Details |
CRISPR targeted
|
|||||||||||||||||||||
| Mode of Inheritance | Semi-dominant | |||||||||||||||||||||
|
||||||||||||||||||||||
| CRISPR types |
Knockout
|
|||||||||||||||||||||
| Knockout details: | Frameshift mutation in exon 2 | |||||||||||||||||||||
| Point mutation sequence: | ||||||||||||||||||||||
| Insertion/Tagging details: | CRISPR induced 10bp deletion targeting exon 2 of Robo2 gene causes frameshift mutation and premature stop. Mouse line generated by Monash Genome Modification Platform/Phenomics Australia. Genotyping: To screen mice for the 10bp Robo2 deletion and wild type mice, a multiplex PCR is performed using 4 different primers. Robo2 primers numbered 1, 2, 3 and 11 are designed to detect the wild type and 10bp deletion. Combination of primers 1 and 11 generate a 205bp wild type band and primers 2 and 3 generate a 422bp mutant band. A band is also seen at approximately 600bp reflecting products generated by primers 1 and 2 which include a mixture of wild type and mutant product which can’t be distinguished due to the small difference in size (10bp). PCR: 95C 5 min, 95C 15 sec, 60C 15 sec, 72c 45 sec x 32, 72C 5 min. Genotyping primers: Robo2-F (Robo Primer 1) accaagagagtgaaatatgggtaa Robo2-R (Robo Primer 2) tgcagagatagtgtattattccaga Robo2-F-Del (Robo Primer 3) cccaggatccttcagatgtc Robo2-R-WT (Robo Primer 11) aagggtgttctacgatcctgg | |||||||||||||||||||||
| Guide(s) RNA sequence: | GGATCGTAGAACACCCTTCT | |||||||||||||||||||||
| Mutant Construction Technique | None | |||||||||||||||||||||
|
Phenotype
|
||||||||||||||||||||||
| Phenotype Homozygous State | Homozygous mice have duplex kidneys during development. Adult phenotype unknown for this line. | |||||||||||||||||||||
| Phenotype Heterozygous State | Normal | |||||||||||||||||||||
| Genetic Background Currently Maintained | C57Bl/6J | |||||||||||||||||||||
|
Strain identification
|
||||||||||||||||||||||
| How is this strain characterised? |
Genotyping
|
|||||||||||||||||||||
|
Fertility and Strain maintenance
|
||||||||||||||||||||||
|
||||||||||||||||||||||
|
Relevant bibliographic / database references
|
||||||||||||||||||||||
|
General information
|
||||||||||||||||||||||
| Associated IP rights? | Unknown | |||||||||||||||||||||
| Does it Model a Human Condition? | Unknown | |||||||||||||||||||||
| Applicable Research Areas |
Immunology and inflammation
Models for human disease Internal/organ Metabolism |
|||||||||||||||||||||
| Is the strain available in any form to other researchers | Possibly | |||||||||||||||||||||
| APB stock stored as: |
Cryopreserved sperm (from 5 mice)
|
|||||||||||||||||||||
| APB stock genotyped verified by: | Unverified | |||||||||||||||||||||
| Are live mice available? | Unknown | |||||||||||||||||||||
| MTA needs to be signed? | Yes | |||||||||||||||||||||
